Stem-loop sequence mdo-mir-146a

AccessionMI0012502 (change log)
DescriptionMonodelphis domestica miR-146a stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   ---------u    c       uu         a  c        gucuu 
5'           guau uucagcu  gagaacuga uu cauggguu     u
             |||| |||||||  ||||||||| || ||||||||      
3'           uaua aggucga  uucuugacu aa guauccag     g
   cuacugucuc    -       -c         c  a        acuau 
Get sequence
Deep sequencing
135784 reads, 2.24e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 356034884-356034974 [+]
intergenic
Database links

Mature sequence mdo-miR-146a-5p

Accession MIMAT0012746
Sequence

15 - 

ugagaacugaauuccauggguu

 - 36

Get sequence
Deep sequencing135781 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-146a-3p

Accession MIMAT0026938
Sequence

51 - 

ccuaugaaacucaguucuucag

 - 72

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).