Stem-loop sequence mdo-mir-140

AccessionMI0012501 (change log)
DescriptionMonodelphis domestica miR-140 stem-loop
Gene family MIPF0000085; mir-140
Stem-loop
       -  a             a       uu   uc 
5' ccug cc gugguuuuacccu ugguagg  acg  a
   |||| || ||||||||||||| |||||||  |||   
3' ggac gg caccaagauggga accaucu  ugu  u
       a  -             c       --   cg 
Get sequence
Deep sequencing
149815 reads, 2.06e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 699870957-699871026 [+]
sense
ENSMODT00000003291 ; WWP2-201; intron 15
Database links

Mature sequence mdo-miR-140-5p

Accession MIMAT0012745
Sequence

6 - 

cagugguuuuacccuaugguag

 - 27

Get sequence
Deep sequencing8439 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-140-3p

Accession MIMAT0026937
Sequence

45 - 

uaccacaggguagaaccacgga

 - 66

Get sequence
Deep sequencing141374 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).