Stem-loop sequence mdo-mir-139

AccessionMI0012500 (change log)
DescriptionMonodelphis domestica miR-139 stem-loop
Gene family MIPF0000117; mir-139
Stem-loop
   -   -      -   u  a            g ga 
5'  ugu auucua cag gc ugugucuccagu u  c
    ||| |||||| ||| || |||||||||||| |  u
3'  aca uaaggu guc cg acauagagguca g  a
   a   a      u   c  -            g ga 
Get sequence
Deep sequencing
10526 reads, 100 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 347282326-347282394 [+]
sense
ENSMODT00000009979 ; PDE2A-201; intron 2
Database links

Mature sequence mdo-miR-139-5p

Accession MIMAT0012744
Sequence

6 - 

ucuacagugcaugugucu

 - 23

Get sequence
Deep sequencing7924 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-139-3p

Accession MIMAT0026936
Sequence

42 - 

uggagauacagcccuguuggaau

 - 64

Get sequence
Deep sequencing2597 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).