Stem-loop sequence mdo-mir-126

AccessionMI0012499 (change log)
DescriptionMonodelphis domestica miR-126 stem-loop
Gene family MIPF0000115; mir-126
Stem-loop
   ---g   -           u       c cug   c 
5'     ggu cauuauuacuu ugguacg g   uga a
       ||| ||||||||||| ||||||| |   |||  
3'     ccg guaauaaugag gccaugc c   acu c
   guua   c           u       u -aa   a 
Get sequence
Deep sequencing
956207 reads, 1.28e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 464882831-464882899 [-]
sense
ENSMODT00000022336 ; EGFL7-201; intron 7
Database links

Mature sequence mdo-miR-126-5p

Accession MIMAT0012743
Sequence

5 - 

cauuauuacuuuugguacgcg

 - 25

Get sequence
Deep sequencing60450 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-126-3p

Accession MIMAT0026935
Sequence

42 - 

ucguaccgugaguaauaaugcg

 - 63

Get sequence
Deep sequencing895753 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).