Stem-loop sequence mdo-mir-106

AccessionMI0012498 (change log)
DescriptionMonodelphis domestica miR-106 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   -- ug   -aa            u    g   guc 
5'   u  ugu   aagugcuuauag gcag uag   g
     |  |||   |||||||||||| |||| |||   u
3'   a  aca   uucacgaguguc cguc auc   g
   cc gu   acc            c    -   aau 
Get sequence
Deep sequencing
19805 reads, 260 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 35203046-35203114 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-106
mdo-mir-106chrX: 35203046-35203114 [-]
mdo-mir-18bchrX: 35202855-35202919 [-]
mdo-mir-20bchrX: 35202543-35202603 [-]
mdo-mir-19b-2chrX: 35202389-35202447 [-]
mdo-mir-92a-2chrX: 35202231-35202295 [-]
mdo-mir-363chrX: 35202082-35202170 [-]
Database links

Mature sequence mdo-miR-106-5p

Accession MIMAT0012742
Sequence

7 - 

aaaagugcuuauagugcagguag

 - 29

Get sequence
Deep sequencing19800 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-106-3p

Accession MIMAT0026934
Sequence

41 - 

acugcccugugagcacuuccaa

 - 62

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).