Stem-loop sequence mdo-mir-190a

AccessionMI0012496 (change log)
DescriptionMonodelphis domestica miR-190a stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   u     c u    - ug               ua     uuau 
5'  gcagg c cugu g  auauguuugauauau  gguug    u
    ||||| | |||| |  |||||||||||||||  |||||     
3'  cgucc g gaca c  uauacaaacuauaua  ucaac    u
   c     u u    u cu               --     cuaa 
Get sequence
Deep sequencing
16105 reads, 140 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 147980881-147980965 [+]
sense
ENSMODT00000014371 ; TLN2-201; intron 51
Database links

Mature sequence mdo-miR-190a-5p

Accession MIMAT0012740
Sequence

15 - 

ugauauguuugauauauuaggu

 - 36

Get sequence
Deep sequencing15928 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-190a-3p

Accession MIMAT0026933
Sequence

52 - 

cuauauaucaaacauauuccu

 - 72

Get sequence
Deep sequencing177 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).