Stem-loop sequence mdo-mir-301

AccessionMI0012495 (change log)
DescriptionMonodelphis domestica miR-301 stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   a     aa  a     c    ---u          ----a       
5'  cugcu  cg augcu ugac    uuauugcacu     cuguac 
    |||||  || ||||| ||||    ||||||||||     ||||| u
3'  gacga  gu uacga acug    gauaacguga     gacauu 
   -     aa  c     a    uuau          cgauc       
Get sequence
Deep sequencing
3548 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 172986774-172986858 [+]
sense
ENSMODT00000043062 ; SKA2-201; intron 1
Clustered miRNAs
< 10kb from mdo-mir-301
mdo-mir-130c-1chr2: 172985794-172985856 [+]
mdo-mir-301chr2: 172986774-172986858 [+]
Database links

Mature sequence mdo-miR-301-5p

Accession MIMAT0026932
Sequence

16 - 

ucugacuuuauugcacuacu

 - 35

Get sequence
Deep sequencing44 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-301-3p

Accession MIMAT0012739
Sequence

51 - 

cagugcaauaguauugucaaagc

 - 73

Get sequence
Deep sequencing3504 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).