Stem-loop sequence mdo-mir-153-2

AccessionMI0012494 (change log)
DescriptionMonodelphis domestica miR-153-2 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   a      g      -             gu       -a  aa 
5'  gcgguu ccggug ucauuuuugugau  ugcagcu  gu  u
    |||||| |||||| |||||||||||||  |||||||  ||  a
3'  ugucaa gguuac agugaaaacacug  acguuga  cg  u
   g      a      u             au       cc  ag 
Get sequence
Deep sequencing
15306 reads, 200 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 224496550-224496636 [-]
sense
ENSMODT00000006626 ; PTPRN2-201; intron 8
Database links

Mature sequence mdo-miR-153-2-5p

Accession MIMAT0026931
Sequence

15 - 

ucauuuuugugauguugcagcu

 - 36

Get sequence
Deep sequencing129 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-153-3p

Accession MIMAT0012738
Sequence

53 - 

uugcauagucacaaaagugauc

 - 74

Get sequence
Deep sequencing30354 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).