Stem-loop sequence mdo-mir-148

AccessionMI0012493 (change log)
DescriptionMonodelphis domestica miR-148 stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
                 ---g a    ca    -   au 
5' gaggcaaaguucug    g cacu  gacu cug  u
   ||||||||||||||    | ||||  |||| |||  a
3' cucuguuucaagac    c guga  cuga gau  g
                 auca -    --    a   ag 
Get sequence
Deep sequencing
110823 reads, 2.1e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 298347764-298347831 [+]
intergenic
Database links

Mature sequence mdo-miR-148-5p

Accession MIMAT0026930
Sequence

6 - 

aaaguucugggacacucagacu

 - 27

Get sequence
Deep sequencing387 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-148-3p

Accession MIMAT0012737
Sequence

44 - 

ucagugcacuacagaacuuugu

 - 65

Get sequence
Deep sequencing110433 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).