Stem-loop sequence mdo-mir-26-1

AccessionMI0012492 (change log)
DescriptionMonodelphis domestica miR-26-1 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   ------------uu         c          -  guc 
5'               caaguaauc aggauaggcu gu   c
                 ||||||||| |||||||||| ||    
3'               guucguuag uccuauccgg cg   a
   cgguggaggucuuu         u          g  ucg 
Get sequence
Deep sequencing
220498 reads, 3.28e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001583875.1: 213879-213947 [-]
intergenic
Database links

Mature sequence mdo-miR-26-5p

Accession MIMAT0012736
Sequence

1 - 

uucaaguaauccaggauaggc

 - 21

Get sequence
Deep sequencing662197 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-26-1-3p

Accession MIMAT0031031
Sequence

38 - 

ccuauccuugauugcuuguuuc

 - 59

Get sequence
Deep sequencing114 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).