Stem-loop sequence mdo-mir-26-3

AccessionMI0012491 (change log)
DescriptionMonodelphis domestica miR-26-3 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   a  u   u      a  c            accc 
5'  cc ggu caagua uc aggauaggcugg    a
    || ||| |||||| || ||||||||||||    u
3'  gg uca guucau ag ucuuauccggcu    u
   -  c   c      c  c            acuc 
Get sequence
Deep sequencing
220720 reads, 3.28e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001584920.1: 60283-60352 [-]
intergenic
Database links

Mature sequence mdo-miR-26-5p

Accession MIMAT0012736
Sequence

7 - 

uucaaguaauccaggauaggc

 - 27

Get sequence
Deep sequencing662197 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-26-3-3p

Accession MIMAT0031030
Sequence

46 - 

ccuauucucgacuacuugcacu

 - 67

Get sequence
Deep sequencing47 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).