Stem-loop sequence mdo-mir-26-2

AccessionMI0012490 (change log)
DescriptionMonodelphis domestica miR-26-2 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   -----   uu         cc           uuu 
5'      ccg  ucaaguaau  aggauaggcug   u
        |||  |||||||||  |||||||||||   c
3'      ggc  gguucauua  ucuuguccgac   u
   ccggg   uu         cc           uuc 
Get sequence
Deep sequencing
221201 reads, 3.28e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 174297322-174297389 [-]
sense
ENSMODT00000037578 ; CTDSP1-201; intron 4
Database links

Mature sequence mdo-miR-26-5p

Accession MIMAT0012736
Sequence

5 - 

uucaaguaauccaggauaggc

 - 25

Get sequence
Deep sequencing662197 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-26-2-3p

Accession MIMAT0026929
Sequence

40 - 

ccuguucuccauuacuugguuc

 - 61

Get sequence
Deep sequencing61 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).