Stem-loop sequence bmo-mir-2806-2

AccessionMI0012455 (change log)
DescriptionBombyx mori miR-2806-2 stem-loop
Stem-loop
   aac          u   -      g           g 
5'    uuuauucuau gca ugucgg uuagagaagcu u
      |||||||||| ||| |||||| ||||||||||| g
3'    aaauaaggua cgu auagcc aaucucuucga c
   gau          -   c      -           a 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004610243.1: 325-398 [+]
intergenic
Database links

Mature sequence bmo-miR-2806

Accession MIMAT0013715
Sequence

43 - 

cuucucuaaccgauacugcaug

 - 64

Get sequence
Deep sequencing17 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).