Stem-loop sequence bmo-mir-2842

AccessionMI0012454 (change log)
DescriptionBombyx mori miR-2842 stem-loop
Stem-loop
   -     -uuucuu    -a   u  ua   g     cc 
5'  ucgac       gaag  ucc cg  cug uggcg  a
    |||||       ||||  ||| ||  ||| |||||   
3'  agcug       cuuc  agg gu  ggc gcugc  u
   g     cugucuu    cg   u  ga   -     cc 
Get sequence
Deep sequencing
81 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004611685.1: 206-279 [+]
intergenic
NW_004612810.1: 5-78 [-]
intergenic
NW_004612893.1: 297-370 [-]
intergenic
NW_004616015.1: 100-173 [-]
intergenic
NW_004618374.1: 430-503 [-]
intergenic
Database links

Mature sequence bmo-miR-2842

Accession MIMAT0013761
Sequence

11 - 

ugaagauccucguacugguggcgc

 - 34

Get sequence
Deep sequencing78 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).