Stem-loop sequence bmo-mir-2820-2

AccessionMI0012440 (change log)
DescriptionBombyx mori miR-2820-2 stem-loop
Gene family MIPF0001034; mir-2820
Stem-loop
   cgucaa    -       a   -      auc    a  g   aug 
5'       gccu auucaug ucc uuuugc   gugc uc ugc   g
         |||| ||||||| ||| ||||||   |||| || |||   c
3'       cgga uaagugc agg agaacg   caug ag gcg   c
   auuucg    a       a   u      --a    c  g   auu 
Get sequence
Deep sequencing
33 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581785.1: 101006-101096 [+]
intergenic
Database links

Mature sequence bmo-miR-2820

Accession MIMAT0013730
Sequence

61 - 

cagcaagauggaacgugaaua

 - 81

Get sequence
Deep sequencing47 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).