Stem-loop sequence bmo-mir-2835

AccessionMI0012437 (change log)
DescriptionBombyx mori miR-2835 stem-loop
Literature search

1 open access papers mention bmo-mir-2835
(4 sentences)

Stem-loop
   a    -       ca   ca       -aa     c uc      
5'  guau ugucucc  uaa  uucauga   guggg a  ccgga 
    |||| |||||||  |||  |||||||   ||||| |  |||| c
3'  uaug acagagg  auu  gaguauu   cacuu u  ggucc 
   a    g       --   uc       aca     - uu      
Get sequence
Deep sequencing
133 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582018.1: 3560887-3560970 [+]
intergenic
Database links

Mature sequence bmo-miR-2835

Accession MIMAT0013749
Sequence

53 - 

ucacacauuaugagcuuuagga

 - 74

Get sequence
Deep sequencing133 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).