Stem-loop sequence bmo-mir-2831-2

AccessionMI0012434 (change log)
DescriptionBombyx mori miR-2831-2 stem-loop
Gene family MIPF0000978; mir-2831
Stem-loop
   g   a                              u 
5'  cac gauggucaagcgaauguuuuguuuguaugu c
    ||| ||||||||||||||||||||||||||||||  
3'  gug cuaccaguuuguuuacgaaacaaacauaca u
   a   g                              u 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582012.1: 8308112-8308185 [-]
intergenic
Database links

Mature sequence bmo-miR-2831

Accession MIMAT0013744
Sequence

43 - 

uacaaacaaagcauuuguuuga

 - 64

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).