Stem-loop sequence bmo-mir-2833-1

AccessionMI0012433 (change log)
DescriptionBombyx mori miR-2833-1 stem-loop
Gene family MIPF0000886; mir-2833
Stem-loop
   aaga      gg    c    g -aa ug   -    u 
5'     auucgc  uaaa agug a   c  guc cuca a
       ||||||  |||| |||| |   |  ||| |||| u
3'     uaagug  guuu ucau u   g  uag gagu g
   gaaa      --    u    g aaa gu   a    u 
Get sequence
Deep sequencing
56 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582024.1: 2473572-2473646 [-]
intergenic
NW_004589597.1: 327-401 [-]
intergenic
NW_004624631.1: 52-126 [-]
intergenic
Database links

Mature sequence bmo-miR-2833

Accession MIMAT0013747
Sequence

43 - 

agagauuggaaauguacuuuuug

 - 65

Get sequence
Deep sequencing112 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).