Stem-loop sequence bmo-mir-2832

AccessionMI0012430 (change log)
DescriptionBombyx mori miR-2832 stem-loop
Stem-loop
   -    u    ---      u  -  cg        ---  c  guua     a 
5'  uuua gaag   guugga ag ug  uuuuggau   gu cc    gguua c
    |||| ||||   |||||| || ||  ||||||||   || ||    ||||| u
3'  aaau cuuc   caacuu uc ac  agagcuug   ca gg    ccagu a
   g    -    acu      c  u  ug        acc  u  --aa     g 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581704.1: 1849214-1849311 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2832
bmo-mir-3317NW_004581704.1: 1850755-1850893 [+]
bmo-mir-2832NW_004581704.1: 1849214-1849311 [-]
Database links

Mature sequence bmo-miR-2832

Accession MIMAT0013746
Sequence

11 - 

uuggauagugcguuuuggauguc

 - 33

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).