Stem-loop sequence bmo-mir-2830-1

AccessionMI0012427 (change log)
DescriptionBombyx mori miR-2830-1 stem-loop
Gene family MIPF0001052; mir-2830
Stem-loop
   ga    -         g      gc  c           
5'   augg aggagugcg ccuggg  ag cgcugaaccc 
     |||| ||||||||| ||||||  || ||||||||| u
3'   ugcu uucucgcgc ggacuc  uc gcgacuuggu 
   ug    a         g      ua  a           
Get sequence
Deep sequencing
351 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581712.1: 225411-225486 [+]
intergenic
NW_004581712.1: 231419-231494 [+]
intergenic
Database links

Mature sequence bmo-miR-2830

Accession MIMAT0013743
Sequence

45 - 

agcgacuaucucagggcgcgcu

 - 66

Get sequence
Deep sequencing688 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).