Stem-loop sequence bmo-mir-2828

AccessionMI0012424 (change log)
DescriptionBombyx mori miR-2828 stem-loop
Literature search

1 open access papers mention bmo-mir-2828
(1 sentences)

Stem-loop
   --------------uucacaacug   u  ga      aa    ucc   aa   a 
5'                         aua uc  uaugug  cggu   gag  cgu g
                           ||| ||  ||||||  ||||   |||  |||  
3'                         ugu ag  auacgc  gcua   uuc  gcg u
   aucagcuacaagcaccuugugcaa   c  ag      --    uuc   ag   u 
Get sequence
Deep sequencing
122 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581767.1: 584242-584339 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2828
bmo-mir-3317NW_004581767.1: 583223-583361 [-]
bmo-mir-2828NW_004581767.1: 584242-584339 [+]
Database links

Mature sequence bmo-miR-2828

Accession MIMAT0013740
Sequence

11 - 

auauucgauaugugaacgguu

 - 31

Get sequence
Deep sequencing116 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).