Stem-loop sequence bmo-mir-2804-3

AccessionMI0012410 (change log)
DescriptionBombyx mori miR-2804-3 stem-loop
Gene family MIPF0000851; mir-2804
Stem-loop
   u       uuucau  c                a      a 
5'  ucgggug      ua aguaguguauuacaau caaagu u
    |||||||      || |||||||||||||||| ||||||  
3'  aguucau      au uugucacauaauguua guuuca g
   -       -----u  a                c      a 
Get sequence
Deep sequencing
42 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581728.1: 455390-455467 [+]
intergenic
Database links

Mature sequence bmo-miR-2804-5p

Accession MIMAT0013709
Previous IDsbmo-miR-2804*
Sequence

19 - 

guaguguauuacaauacaaagu

 - 40

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence bmo-miR-2804-3p

Accession MIMAT0013710
Previous IDsbmo-miR-2804
Sequence

47 - 

uuugcauuguaauacacuguua

 - 68

Get sequence
Deep sequencing158 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).