Stem-loop sequence bmo-mir-2822-1

AccessionMI0012408 (change log)
DescriptionBombyx mori miR-2822-1 stem-loop
Gene family MIPF0000970; mir-2822
Stem-loop
   ggucuua       uuu          a    au 
5'        ugcaagu   guaaaguguc ccuu  u
          |||||||   |||||||||| ||||   
3'        acguucg   cauuuuauag ggaa  c
   guauuaa       ccu          -    gu 
Get sequence
Deep sequencing
51 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582015.1: 3614752-3614820 [-]
intergenic
Database links

Mature sequence bmo-miR-2822

Accession MIMAT0013733
Sequence

40 - 

agggauauuuuacuccgcuu

 - 59

Get sequence
Deep sequencing65 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).