Stem-loop sequence bmo-mir-2780a-3

AccessionMI0012406 (change log)
DescriptionBombyx mori miR-2780a-3 stem-loop
Gene family MIPF0000828; mir-2780
Stem-loop
   -   cgg   aaa      -       a a   --a            
5'  cca   uga   gggugu uaaauga g cuu   uggcuucgguc 
    |||   |||   |||||| ||||||| | |||   |||||||||| a
3'  ggu   acu   cucgua guuugcu c gga   auugaagcuau 
   a   -aa   --g      a       a a   caa            
Get sequence
Deep sequencing
1013 reads, 66.7 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582015.1: 1839171-1839258 [+]
intergenic
Database links

Mature sequence bmo-miR-2780a-5p

Accession MIMAT0013669
Previous IDsbmo-miR-2780a
Sequence

11 - 

aaggguguuaaaugaagacuuau

 - 33

Get sequence
Deep sequencing2594 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).