Stem-loop sequence bmo-mir-2817

AccessionMI0012401 (change log)
DescriptionBombyx mori miR-2817 stem-loop
Stem-loop
   u  g      aa       g  ua a   a - u 
5'  uc uuucca  caagacu cg  g ccg g c u
    || ||||||  ||||||| ||  | ||| | | u
3'  ag gaaggu  guucuga gc  c ggu c g a
   c  -      -c       -  cg -   c a u 
Get sequence
Deep sequencing
281 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581682.1: 2313365-2313430 [-]
intergenic
NW_004581700.1: 1707224-1707289 [+]
intergenic
NW_004581805.1: 310515-310580 [+]
intergenic
Database links

Mature sequence bmo-miR-2817

Accession MIMAT0013727
Sequence

11 - 

aacaagacugcguagaccgag

 - 31

Get sequence
Deep sequencing242 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).