Stem-loop sequence bmo-mir-2812

AccessionMI0012393 (change log)
DescriptionBombyx mori miR-2812 stem-loop
Stem-loop
   c      ccug    aau gag   c             agauuau 
5'  ccuggc    ucag   c   uua uacagccuggacg       g
    ||||||    ||||   |   ||| |||||||||||||        
3'  gggccg    aguc   g   gau augucggaccugc       g
   -      --ug    --g aaa   a             cacgccg 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582057.1: 21571-21659 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2812
bmo-mir-2812NW_004582057.1: 21571-21659 [-]
bmo-mir-3297NW_004582057.1: 13038-13175 [+]
bmo-mir-3297NW_004582057.1: 11225-11362 [+]
Database links

Mature sequence bmo-miR-2812

Accession MIMAT0013720
Sequence

60 - 

caggcuguaauagaaaggcu

 - 79

Get sequence
Deep sequencing15 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).