Stem-loop sequence bmo-mir-2810

AccessionMI0012390 (change log)
DescriptionBombyx mori miR-2810 stem-loop
Stem-loop
   aa    -aga   -      -ga -        auu  g 
5'   guaa    gag auuuuc   g aacagcua   cg c
     ||||    ||| ||||||   | ||||||||   ||  
3'   cguu    cuc uagaag   c uugucggu   gc u
   uc    gcga   g      acg g        ---  g 
Get sequence
Deep sequencing
288 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581689.1: 1792245-1792317 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2810
bmo-mir-2810NW_004581689.1: 1792245-1792317 [+]
bmo-mir-3245NW_004581689.1: 1797493-1797604 [+]
Database links

Mature sequence bmo-miR-2810

Accession MIMAT0013718
Sequence

11 - 

agauuuucgagaacagcuaauu

 - 32

Get sequence
Deep sequencing287 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).