Stem-loop sequence bmo-mir-2809

AccessionMI0012389 (change log)
DescriptionBombyx mori miR-2809 stem-loop
Literature search

1 open access papers mention bmo-mir-2809
(2 sentences)

Stem-loop
   ua  cg     aaa         ---g uc  -  g -ug  aac g 
5'   cu  aagcg   cagcgaacg    a  ac cu a   cg   c g
     ||  |||||   |||||||||    |  || || |   ||   |  
3'   ga  uuugu   guuguuugu    u  ug ga u   gc   g a
   ac  au     -ga         gaaa uu  a  g uaa  gaa a 
Get sequence
Deep sequencing
699 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582008.1: 5919909-5919998 [-]
intergenic
Database links

Mature sequence bmo-miR-2809

Accession MIMAT0013717
Sequence

11 - 

gaaacagcgaacggaucaccugau

 - 34

Get sequence
Deep sequencing664 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).