Stem-loop sequence bmo-mir-2807a-1

AccessionMI0012385 (change log)
DescriptionBombyx mori miR-2807a-1 stem-loop
Gene family MIPF0000826; mir-2807
Stem-loop
   u        ag c           a          cu     -au  u 
5'  aaaaguua  u aaauuuguaug aguuggaacg  ugccu   gu u
    ||||||||  | ||||||||||| ||||||||||  |||||   || g
3'  uuuucaau  a uuuaaacauac ucgaccuugu  acggg   cg c
   -        gg c           g          -c     gau  c 
Get sequence
Deep sequencing
65 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581758.1: 99259-99354 [-]
intergenic
Database links

Mature sequence bmo-miR-2807a

Accession MIMAT0013716
Sequence

65 - 

uuccagcugcauacaaauuuca

 - 86

Get sequence
Deep sequencing126 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).