Stem-loop sequence bmo-mir-2803

AccessionMI0012379 (change log)
DescriptionBombyx mori miR-2803 stem-loop
Stem-loop
   ccau     a    c u   -      c     ca a    
5'     ggcuu ugga g uac caaugc aggga  g gcc 
       ||||| |||| | ||| |||||| |||||  | || a
3'     ccgga gccu u aug guuacg uccuu  c cga 
   ugcu     c    c c   a      a     cg -    
Get sequence
Deep sequencing
13 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582017.1: 93740-93818 [+]
intergenic
Database links

Mature sequence bmo-miR-2803

Accession MIMAT0013708
Sequence

11 - 

uggacguuaccaaugccaggga

 - 32

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).