Stem-loop sequence bmo-mir-2801

AccessionMI0012377 (change log)
DescriptionBombyx mori miR-2801 stem-loop
Stem-loop
   -          gug      -   g -  - ug  -aa       c 
5'  cacauguuua   gaaucu ugu a cu u  ua   gugcuug a
    ||||||||||   |||||| ||| | || |  ||   |||||||  
3'  guguacgaau   uuugga aca u gg a  gu   uacggac a
   g          ---      g   g c  u gu  gcg       u 
Get sequence
Deep sequencing
70 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004586827.1: 393-478 [+]
intergenic
Database links

Mature sequence bmo-miR-2801

Accession MIMAT0013705
Sequence

11 - 

guggaaucuugugacuuuguaaag

 - 34

Get sequence
Deep sequencing69 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).