Stem-loop sequence bmo-mir-2797d

AccessionMI0012373 (change log)
DescriptionBombyx mori miR-2797d stem-loop
Stem-loop
   -----------------ugucguguuua        cau   c       uug 
5'                             uaaguaga   ugu cggcuug   u
                               ||||||||   ||| |||||||    
3'                             auucgucu   aca gcugaac   u
   gcggcgcgugacguagagcagugccaac        aau   a       uac 
Get sequence
Deep sequencing
44 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581747.1: 1275750-1275840 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2797d
bmo-mir-274NW_004581747.1: 1284148-1284242 [-]
bmo-mir-2797dNW_004581747.1: 1275750-1275840 [-]
bmo-mir-2797cNW_004581747.1: 1275549-1275624 [-]
bmo-mir-2797bNW_004581747.1: 1275307-1275383 [-]
bmo-mir-2797aNW_004581747.1: 1275167-1275243 [-]
Database links

Mature sequence bmo-miR-2797d

Accession MIMAT0013701
Sequence

11 - 

auaaguagacauuguccggcuu

 - 32

Get sequence
Deep sequencing44 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).