Stem-loop sequence bmo-mir-2797c

AccessionMI0012372 (change log)
DescriptionBombyx mori miR-2797c stem-loop
Gene family MIPF0000911; mir-2797
Stem-loop
   -   g    a  u       u     u a     ugu 
5'  uau auua ca aaguagg uuuau c guuug   u
    ||| |||| || ||||||| ||||| | |||||   u
3'  aua uagu gu uucaucc aaaua g caaac   c
   a   g    c  u       c     u c     uua 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581747.1: 1275549-1275624 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2797c
bmo-mir-274NW_004581747.1: 1284148-1284242 [-]
bmo-mir-2797dNW_004581747.1: 1275750-1275840 [-]
bmo-mir-2797cNW_004581747.1: 1275549-1275624 [-]
bmo-mir-2797bNW_004581747.1: 1275307-1275383 [-]
bmo-mir-2797aNW_004581747.1: 1275167-1275243 [-]
Database links

Mature sequence bmo-miR-2797c

Accession MIMAT0013700
Sequence

11 - 

auaaguagguuuuauucaguuu

 - 32

Get sequence
Deep sequencing40 reads, 2 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).