Stem-loop sequence bmo-mir-2797b

AccessionMI0012371 (change log)
DescriptionBombyx mori miR-2797b stem-loop
Gene family MIPF0000911; mir-2797
Stem-loop
   ua    a  ca          cuu  u     a  uuu 
5'   ucgu ag  uaaguagguu   au cggcu ug   u
     |||| ||  ||||||||||   || ||||| ||   c
3'   agcg uc  auucauccga   ua gccga ac   a
   ac    g  ag          -au  c     -  uua 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581747.1: 1275307-1275383 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2797b
bmo-mir-274NW_004581747.1: 1284148-1284242 [-]
bmo-mir-2797dNW_004581747.1: 1275750-1275840 [-]
bmo-mir-2797cNW_004581747.1: 1275549-1275624 [-]
bmo-mir-2797bNW_004581747.1: 1275307-1275383 [-]
bmo-mir-2797aNW_004581747.1: 1275167-1275243 [-]
Database links

Mature sequence bmo-miR-2797b

Accession MIMAT0013699
Sequence

11 - 

auaaguagguucuuauucggcu

 - 32

Get sequence
Deep sequencing11 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).