Stem-loop sequence bmo-mir-2797a

AccessionMI0012370 (change log)
DescriptionBombyx mori miR-2797a stem-loop
Gene family MIPF0000911; mir-2797
Stem-loop
   -u  u  g    u       u     u      u uuc 
5'   gu gu auca aaguagg uuuau cgacuu g   u
     || || |||| ||||||| ||||| |||||| |    
3'   cg ca uagu uucaucc aagug gcugaa u   a
   ag  u  g    u       u     c      c uau 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581747.1: 1275167-1275243 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2797a
bmo-mir-274NW_004581747.1: 1284148-1284242 [-]
bmo-mir-2797dNW_004581747.1: 1275750-1275840 [-]
bmo-mir-2797cNW_004581747.1: 1275549-1275624 [-]
bmo-mir-2797bNW_004581747.1: 1275307-1275383 [-]
bmo-mir-2797aNW_004581747.1: 1275167-1275243 [-]
Database links

Mature sequence bmo-miR-2797a

Accession MIMAT0013698
Sequence

11 - 

auaaguagguuuuauucgacuu

 - 32

Get sequence
Deep sequencing38 reads, 2 experiments
Evidence experimental; Illumina [1], SOLID [2]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).