Stem-loop sequence bmo-mir-2795

AccessionMI0012368 (change log)
DescriptionBombyx mori miR-2795 stem-loop
Stem-loop
   -   cc cacac   uu  -     acg     g  gu 
5'  cgu  c     aag  ug gugau   cgggc ca  u
    |||  |     |||  || |||||   ||||| ||  u
3'  gca  g     uuc  gc cgcua   gcccg gu  u
   u   uu cuucu   uc  u     -ca     -  ga 
Get sequence
Deep sequencing
83 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582019.1: 3375941-3376015 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2795
bmo-mir-100NW_004582019.1: 3376172-3376313 [-]
bmo-mir-2795NW_004582019.1: 3375941-3376015 [-]
bmo-let-7NW_004582019.1: 3373685-3373788 [-]
Database links

Mature sequence bmo-miR-2795

Accession MIMAT0013695
Sequence

11 - 

caaguuuggugauacgcgggcgc

 - 33

Get sequence
Deep sequencing83 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).