Stem-loop sequence bmo-mir-2788

AccessionMI0012361 (change log)
DescriptionBombyx mori miR-2788 stem-loop
Gene family MIPF0001204; mir-2788
Stem-loop
   -   -   gaac         a   c     g   cuuc 
5'  gcc gua    ugggguuuc aag gguau ugc    g
    ||| |||    ||||||||| ||| ||||| |||     
3'  cgg cgu    acccuaaag uuc ccgua acg    a
   g   u   gcaa         g   -     -   uauu 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581682.1: 2332511-2332586 [-]
intergenic
Database links

Mature sequence bmo-miR-2788

Accession MIMAT0013685
Sequence

11 - 

ugggguuucaaagcgguaugug

 - 32

Get sequence
Deep sequencing10 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).