Stem-loop sequence bmo-mir-2785

AccessionMI0012358 (change log)
DescriptionBombyx mori miR-2785 stem-loop
Stem-loop
   acc      c    g      a        a     ua 
5'    ggaugu uuag ccucgu ccgcacug auuaa  u
      |||||| |||| |||||| |||||||| |||||  a
3'    ccugca aauc ggagca ggcgugac uaauu  a
   uac      a    -      a        g     uu 
Get sequence
Deep sequencing
54 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582011.1: 5998625-5998702 [+]
intergenic
NW_004582036.1: 966244-966321 [+]
intergenic
Database links

Mature sequence bmo-miR-2785

Accession MIMAT0013681
Sequence

48 - 

ugcagugcggaacgaggcuaa

 - 68

Get sequence
Deep sequencing54 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).