Stem-loop sequence bmo-mir-2808c

AccessionMI0012346 (change log)
DescriptionBombyx mori miR-2808c stem-loop
Literature search

1 open access papers mention bmo-mir-2808c
(1 sentences)

Stem-loop
   cac     ---uuc   ac      -    g  u      c 
5'    agagu      ucg  ggaucu ucgc gg uugggu g
      |||||      |||  |||||| |||| || ||||||  
3'    ucucg      agc  cuuaga ggug uc agcuua c
   uuu     uaacaa   ga      u    g  u      u 
Get sequence
Deep sequencing
256 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004624681.1: 4062-4141 [+]
intergenic
Database links

Mature sequence bmo-miR-2808c

Accession MIMAT0013671
Sequence

49 - 

uggugguagauucagcgaaaca

 - 70

Get sequence
Deep sequencing196 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).