Stem-loop sequence bmo-mir-2779

AccessionMI0012344 (change log)
DescriptionBombyx mori miR-2779 stem-loop
Stem-loop
   uugcugguu    -    -      agg      ugu 
5'          uaua uccg gcucga   accaua   u
            |||| |||| ||||||   ||||||    
3'          augu aggu cgaguu   uggugu   g
   uuauuguuu    c    g      -aa      ugc 
Get sequence
Deep sequencing
1754 reads, 133 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582020.1: 6075805-6075877 [-]
intergenic
Database links

Mature sequence bmo-miR-2779

Accession MIMAT0013668
Sequence

11 - 

auauccggcucgaaggacca

 - 30

Get sequence
Deep sequencing1753 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).