Stem-loop sequence bmo-mir-2771

AccessionMI0012328
DescriptionBombyx mori miR-2771 stem-loop
Stem-loop
   u     cuuuua      c a -ga  g  -u  --g        guc   ac 
5'  cccaa      acauua g g   ug gu  ua   uuagggga   cca  u
    |||||      |||||| | |   || ||  ||   ||||||||   |||   
3'  ggguu      uguaau c c   ac ua  au   aguccccu   ggu  g
   -     -accca      - a aag  g  uu  aga        ---   ga 
Get sequence
Deep sequencing
45 reads, 11.5 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2860: 640667-640764 [+]
intergenic
nscaf2888: 8708285-8708382 [-]
intergenic

Mature sequence bmo-miR-2771-5p

Accession MIMAT0013654
Previous IDsbmo-miR-2771*
Sequence

11 - 

uaacauuacgaggauggguuuaguua

 - 36

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence bmo-miR-2771-3p

Accession MIMAT0013655
Previous IDsbmo-miR-2771
Sequence

67 - 

auauuaugcagaacacuaaugu

 - 88

Get sequence
Deep sequencing36 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).