Stem-loop sequence bmo-mir-375

AccessionMI0012324 (change log)
DescriptionBombyx mori miR-375 stem-loop
Literature search

1 open access papers mention bmo-mir-375
(2 sentences)

Stem-loop
   --ca  aa      c     -  uc           u  c 
5'     gc  ggcgac cgagc gg  ugagcaaacug ga a
       ||  |||||| ||||| ||  ||||||||||| || a
3'     cg  ccgcug gcucg cc  gcuuguuugau cu u
   acug  aa      u     g  cc           -  a 
Get sequence
Deep sequencing
18180 reads, 3.5e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581700.1: 2059423-2059501 [+]
intergenic
Database links

Mature sequence bmo-miR-375-5p

Accession MIMAT0013648
Previous IDsbmo-miR-375
Sequence

11 - 

acccgagcggucugagcaaacu

 - 32

Get sequence
Deep sequencing13122 reads, 3 experiments
Evidence experimental; Illumina [1-2], SOLID [3]
Database links

Mature sequence bmo-miR-375-3p

Accession MIMAT0013649
Previous IDsbmo-miR-375*
Sequence

47 - 

uuuguucgccccggcucgugucg

 - 69

Get sequence
Deep sequencing5058 reads, 3 experiments
Evidence experimental; Illumina [1-2], SOLID [3]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).
3
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).