Stem-loop sequence bmo-mir-2768

AccessionMI0012323 (change log)
DescriptionBombyx mori miR-2768 stem-loop
Stem-loop
   -         c     a                 uauauauc    uga 
5'  gucgggcga cggug aauauuuugaccaauuu        gguc   u
    ||||||||| ||||| |||||||||||||||||        ||||    
3'  uagcucguu gcuac uuauagaauugguuaag        ucag   c
   c         u     g                 --uggaac    uug 
Get sequence
Deep sequencing
319 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582034.1: 4213060-4213156 [-]
intergenic
Database links

Mature sequence bmo-miR-2768-5p

Accession MIMAT0013646
Previous IDsbmo-miR-2768*
Sequence

11 - 

cggugaaauauuuugaccaauu

 - 32

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1], SOLID [2]

Mature sequence bmo-miR-2768-3p

Accession MIMAT0013647
Previous IDsbmo-miR-2768
Sequence

66 - 

auugguuaagauauugcaucgu

 - 87

Get sequence
Deep sequencing314 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).