Stem-loop sequence bmo-mir-750

AccessionMI0012322 (change log)
DescriptionBombyx mori miR-750 stem-loop
Gene family MIPF0000796; mir-750
Literature search

2 open access papers mention bmo-mir-750
(2 sentences)

Stem-loop
   c       c         c   -      u a    uuca 
5'  uucaugu ugaguugga agg ggaucu g cagu    u
    ||||||| ||||||||| ||| |||||| | ||||     
3'  aggugcg acucgaccu ucu ucuaga c gucg    g
   -       c         u   a      c -    cuug 
Get sequence
Deep sequencing
688 reads, 66.7 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581697.1: 1536089-1536167 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-750
bmo-mir-750NW_004581697.1: 1536089-1536167 [-]
bmo-mir-1175NW_004581697.1: 1535938-1536019 [-]
Database links

Mature sequence bmo-miR-750-5p

Accession MIMAT0013644
Previous IDsbmo-miR-750*
Sequence

12 - 

aguuggacaggggaucuugaca

 - 33

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1], SOLID [2]

Mature sequence bmo-miR-750-3p

Accession MIMAT0013645
Previous IDsbmo-miR-750
Sequence

50 - 

ccagaucuaucuuuccagcu

 - 69

Get sequence
Deep sequencing682 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).