Stem-loop sequence bmo-mir-2767

AccessionMI0012321 (change log)
DescriptionBombyx mori miR-2767 stem-loop
Gene family MIPF0001446; mir-2767
   -  c  ug   c                     ucu 
5'  ac gu  uuu aaguaaaucucgugcgguuug   c
    || ||  ||| |||||||||||||||||||||    
3'  ug ua  aaa uucauuuagaguaugccaagc   a
   g  u  gu   a                     cuu 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 3 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581747.1: 877156-877228 [+]
Database links

Mature sequence bmo-miR-2767

Accession MIMAT0013643

11 - 


 - 32

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [1]


PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).