Stem-loop sequence bmo-mir-2767

AccessionMI0012321
DescriptionBombyx mori miR-2767 stem-loop
Gene family MIPF0001446; mir-2767
Stem-loop
   -  c  ug   c                     ucu 
5'  ac gu  uuu aaguaaaucucgugcgguuug   c
    || ||  ||| |||||||||||||||||||||    
3'  ug ua  aaa uucauuuagaguaugccaagc   a
   g  u  gu   a                     cuu 
Get sequence
Deep sequencing
8 reads, 3.09 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf1071: 874636-874708 [+]
intergenic

Mature sequence bmo-miR-2767

Accession MIMAT0013643
Sequence

11 - 

caaguaaaucucgugcgguuug

 - 32

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).