Stem-loop sequence bmo-mir-2766

AccessionMI0012320
DescriptionBombyx mori miR-2766 stem-loop
Gene family MIPF0001608; mir-2766
Stem-loop
   cauu    gu     c    u uu     gc  ugu 
5'     acuc  ccgcc uucg c  gacug  gc   c
       ||||  ||||| |||| |  |||||  ||    
3'     ugag  ggugg aagc g  cugac  cg   g
   -cuu    ug     u    u uu     ua  uuc 
Get sequence
Deep sequencing
68289 reads, 2.28e+04 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2686: 161868-161940 [-]
intergenic

Mature sequence bmo-miR-2766-5p

Accession MIMAT0013641
Previous IDsbmo-miR-2766*
Sequence

11 - 

ccgcccuucgucuugacuggcg

 - 32

Get sequence
Deep sequencing256 reads, 3 experiments
Evidence experimental; Illumina [1-2]

Mature sequence bmo-miR-2766-3p

Accession MIMAT0013642
Previous IDsbmo-miR-2766
Sequence

45 - 

ucagucuugucgaauggug

 - 63

Get sequence
Deep sequencing61052 reads, 3 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).