Stem-loop sequence bmo-mir-2763

AccessionMI0012317
DescriptionBombyx mori miR-2763 stem-loop
Gene family MIPF0001437; mir-2763
Stem-loop
   --g        c g     u     a      ----------uu   g 
5'    gcaaugua u caaag aguga cauaau            auc u
      |||||||| | ||||| ||||| ||||||            |||  
3'    uguuguau a guuuc uuacu guauua            uag g
   gca        - g     u     c      uagauuauuauu   a 
Get sequence
Deep sequencing
18 reads, 6.19 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf3041: 1482848-1482932 [+]
intergenic

Mature sequence bmo-miR-2763-5p

Accession MIMAT0013637
Previous IDsbmo-miR-2763*
Sequence

11 - 

ugcaaaguagugaacauaauuuau

 - 34

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1-2], SOLID [3]

Mature sequence bmo-miR-2763-3p

Accession MIMAT0013638
Previous IDsbmo-miR-2763
Sequence

54 - 

uauuaugcucauuucuuuggau

 - 75

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence experimental; Illumina [1-2], SOLID [3]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).
3
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).