Stem-loop sequence bmo-mir-2762

AccessionMI0012316 (change log)
DescriptionBombyx mori miR-2762 stem-loop
Stem-loop
   uuuac           c        uu          ga  g 
5'      uauuuuaccgu acauuucu  auguaucacg  ug a
        ||||||||||| ||||||||  ||||||||||  ||  
3'      auaaaauggca uguaaagg  ugcauggugc  ac g
   uuagu           -        gc          --  a 
Get sequence
Deep sequencing
935 reads, 66.7 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581721.1: 994724-994806 [-]
intergenic
Database links

Mature sequence bmo-miR-2762

Accession MIMAT0013636
Sequence

52 - 

guacgucgggaaauguacggua

 - 73

Get sequence
Deep sequencing934 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).