Stem-loop sequence bmo-mir-2761

AccessionMI0012315 (change log)
DescriptionBombyx mori miR-2761 stem-loop
Literature search

1 open access papers mention bmo-mir-2761
(33 sentences)

Stem-loop
   --auagacgcug      -                -     
5'             caucga gacgguuccauacaag cugc 
               |||||| |||||||||||||||| ||| a
3'             guagcu cugccaagguguguuc gacc 
   uuaauaaaaaag      g                a     
Get sequence
Deep sequencing
121 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582030.1: 3064114-3064190 [-]
intergenic
Database links

Mature sequence bmo-miR-2761-5p

Accession MIMAT0013634
Previous IDsbmo-miR-2761*
Sequence

11 - 

caucgagacgguuccauaca

 - 30

Get sequence
Deep sequencing18 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence bmo-miR-2761-3p

Accession MIMAT0013635
Previous IDsbmo-miR-2761
Sequence

45 - 

uguguggaaccgucgucgaugga

 - 67

Get sequence
Deep sequencing103 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).