Stem-loop sequence bmo-mir-2760

AccessionMI0012314 (change log)
DescriptionBombyx mori miR-2760 stem-loop
Stem-loop
   --c         c ag       ug           --------     c 
5'    cgaaugaaa g  gcuuaau  aaccaaaaagc        gcauc a
      ||||||||| |  |||||||  |||||||||||        ||||| c
3'    guuuauuuu c  ugaauug  uugguuuuuug        uguag u
   gau         a cu       --           acaaaauu     u 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582030.1: 2421649-2421739 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2760
bmo-mir-2760NW_004582030.1: 2421649-2421739 [-]
bmo-mir-2745NW_004582030.1: 2421486-2421564 [-]
Database links

Mature sequence bmo-miR-2760-5p

Accession MIMAT0013632
Previous IDsbmo-miR-2760*
Sequence

11 - 

cgaggcuuaauugaaccaaaaagc

 - 34

Get sequence
Deep sequencing14 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence bmo-miR-2760-3p

Accession MIMAT0013633
Previous IDsbmo-miR-2760
Sequence

60 - 

uuuuugguuguuaaguuccauu

 - 81

Get sequence
Deep sequencing48 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).